Review



tcf7l2 sequence  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc tcf7l2 sequence
    Fig. 4. <t>TCF7L2</t> dose-dependently modulates WNT/β-catenin signaling. (A) AXIN2 mRNA levels (one-way ANOVA followed by Tukey's multiple comparisons test), (B) TOPFlash promoter activity following 6 h treatment with vehicle (Veh) or 50 ng/ml WNT3A (n = 12 wells/group) (two-way ANOVA, aaaTreatment * Genotype p < 0.001, bbbTreatment P < 0.001, cccGenotype P < 0.001 followed by ˇSíd´ak's multiple comparisons test), (C) whole cell lysate active β-catenin protein levels (one-way ANOVA followed by Tukey's multiple comparisons test), and (D) TCF7 mRNA levels following TCF7L2 KD in DFAT abdominal APs and primary abdominal APs (n = 2 subjects [0F]; mean age = 45.5. Mean BMI = 29.12; rs7903146 genotype [CC]). (One-way ANOVA followed by Tukey's multiple comparisons test.) (E) TCF7 protein levels in TCF7L2 KD DFAT abdominal APs (one-way ANOVA followed by Tukey's multiple comparisons test). shCN = scrambled control, sh897 = moderate and sh843 = high TCF7L2-KD DFAT abdominal APs. Actin was used as a loading control for western blots. qRT-PCR data were normalized to 18S rRNA levels. Histograms are means ± SEM. Data obtained from 3 independent experiments. ###P < 0.001, ##P < 0.01, #P < 0.05 (adjusted for multiple comparisons).
    Tcf7l2 Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tcf7l2+sequence/Myc-tagged+human+full+length+TCF4E+pcDNA3+(Plasmid+%2332738)/pm35697299-62-1-11
    Average 93 stars, based on 9 article reviews
    tcf7l2 sequence - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes."

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes.

    Journal: Metabolism: clinical and experimental

    doi: 10.1016/j.metabol.2022.155240

    Fig. 4. TCF7L2 dose-dependently modulates WNT/β-catenin signaling. (A) AXIN2 mRNA levels (one-way ANOVA followed by Tukey's multiple comparisons test), (B) TOPFlash promoter activity following 6 h treatment with vehicle (Veh) or 50 ng/ml WNT3A (n = 12 wells/group) (two-way ANOVA, aaaTreatment * Genotype p < 0.001, bbbTreatment P < 0.001, cccGenotype P < 0.001 followed by ˇSíd´ak's multiple comparisons test), (C) whole cell lysate active β-catenin protein levels (one-way ANOVA followed by Tukey's multiple comparisons test), and (D) TCF7 mRNA levels following TCF7L2 KD in DFAT abdominal APs and primary abdominal APs (n = 2 subjects [0F]; mean age = 45.5. Mean BMI = 29.12; rs7903146 genotype [CC]). (One-way ANOVA followed by Tukey's multiple comparisons test.) (E) TCF7 protein levels in TCF7L2 KD DFAT abdominal APs (one-way ANOVA followed by Tukey's multiple comparisons test). shCN = scrambled control, sh897 = moderate and sh843 = high TCF7L2-KD DFAT abdominal APs. Actin was used as a loading control for western blots. qRT-PCR data were normalized to 18S rRNA levels. Histograms are means ± SEM. Data obtained from 3 independent experiments. ###P < 0.001, ##P < 0.01, #P < 0.05 (adjusted for multiple comparisons).
    Figure Legend Snippet: Fig. 4. TCF7L2 dose-dependently modulates WNT/β-catenin signaling. (A) AXIN2 mRNA levels (one-way ANOVA followed by Tukey's multiple comparisons test), (B) TOPFlash promoter activity following 6 h treatment with vehicle (Veh) or 50 ng/ml WNT3A (n = 12 wells/group) (two-way ANOVA, aaaTreatment * Genotype p < 0.001, bbbTreatment P < 0.001, cccGenotype P < 0.001 followed by ˇSíd´ak's multiple comparisons test), (C) whole cell lysate active β-catenin protein levels (one-way ANOVA followed by Tukey's multiple comparisons test), and (D) TCF7 mRNA levels following TCF7L2 KD in DFAT abdominal APs and primary abdominal APs (n = 2 subjects [0F]; mean age = 45.5. Mean BMI = 29.12; rs7903146 genotype [CC]). (One-way ANOVA followed by Tukey's multiple comparisons test.) (E) TCF7 protein levels in TCF7L2 KD DFAT abdominal APs (one-way ANOVA followed by Tukey's multiple comparisons test). shCN = scrambled control, sh897 = moderate and sh843 = high TCF7L2-KD DFAT abdominal APs. Actin was used as a loading control for western blots. qRT-PCR data were normalized to 18S rRNA levels. Histograms are means ± SEM. Data obtained from 3 independent experiments. ###P < 0.001, ##P < 0.01, #P < 0.05 (adjusted for multiple comparisons).

    Techniques Used: Activity Assay, Control, Western Blot, Quantitative RT-PCR

    Fig. 5. Global transcriptional profiling reveals that TCF7L2 regulates multiple aspects of AP biology. (A) Principal component analysis (PCA) of the global tran scriptomic profile of control (scrambled), moderate (sh897) and high-efficiency (sh843) TCF7L2-KD DFAT abdominal APs over 3 independent passages. (B) Venn diagram showing the overlap between differentially regulated genes from paired comparisons (FDR < 0.05). (C and D) Volcano plots showing the genes differentially regulated between control and (C) sh843 (TCF7 was one of top 30 differentially regulated genes highlighted in yellow); or (D) sh897, TCF7L2-KD DFAT abdominal APs. Highlighted are the top 30 differentially regulated genes. (E) Overrepresentation analyses of genes differentially regulated in sh843 and sh897 DFAT abdominal APs, vs. controls in gene ontology biological processes gene sets. P-value was adjusted using the FDR (Benjamini-Hochberg) procedure. Gene ratio represents the percentage of total DEGs in the given GO term. (F) Dimensional reduction of transcription factors similarity by co-regulation of targets (see Supplementary methods). Colors represent high dimensional clustering by affinity propagation. (G) Dendrogram of transcription factors Euclidean distance. (H) JUB, MEF2A and TEAD1 expression levels in high- and low-efficiency TCF7L2-KD cells (vs. scramble control) are shown. Padj is annotated for RNAseq log2 fold-change measurements. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
    Figure Legend Snippet: Fig. 5. Global transcriptional profiling reveals that TCF7L2 regulates multiple aspects of AP biology. (A) Principal component analysis (PCA) of the global tran scriptomic profile of control (scrambled), moderate (sh897) and high-efficiency (sh843) TCF7L2-KD DFAT abdominal APs over 3 independent passages. (B) Venn diagram showing the overlap between differentially regulated genes from paired comparisons (FDR < 0.05). (C and D) Volcano plots showing the genes differentially regulated between control and (C) sh843 (TCF7 was one of top 30 differentially regulated genes highlighted in yellow); or (D) sh897, TCF7L2-KD DFAT abdominal APs. Highlighted are the top 30 differentially regulated genes. (E) Overrepresentation analyses of genes differentially regulated in sh843 and sh897 DFAT abdominal APs, vs. controls in gene ontology biological processes gene sets. P-value was adjusted using the FDR (Benjamini-Hochberg) procedure. Gene ratio represents the percentage of total DEGs in the given GO term. (F) Dimensional reduction of transcription factors similarity by co-regulation of targets (see Supplementary methods). Colors represent high dimensional clustering by affinity propagation. (G) Dendrogram of transcription factors Euclidean distance. (H) JUB, MEF2A and TEAD1 expression levels in high- and low-efficiency TCF7L2-KD cells (vs. scramble control) are shown. Padj is annotated for RNAseq log2 fold-change measurements. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Techniques Used: Control, Expressing

    Fig. 7. Schematic summarizing the role of TCF7L2 and impact of rs7903146 genotype on human AP biology. TCF7L2 has dose-dependent effects on adipo genesis with moderate and high-efficiency knockdown leading to enhanced and impaired adipogenesis respectively in vitro. In fractionated adipose tissue expression of TCF7L2 in APs correlates positively with donor BMI whilst the T2D risk variant (T) at rs7903146 is associated with reduced AP TCF7L2 expression. Based on these findings we speculate that lean homozygous T2D risk variant carriers would have the lowest AP TCF7L2 expression and conse quently impaired adipogenesis, larger adipocytes, increased adipo-IR and higher susceptibility to T2D compared with obese T2D risk variant carriers.
    Figure Legend Snippet: Fig. 7. Schematic summarizing the role of TCF7L2 and impact of rs7903146 genotype on human AP biology. TCF7L2 has dose-dependent effects on adipo genesis with moderate and high-efficiency knockdown leading to enhanced and impaired adipogenesis respectively in vitro. In fractionated adipose tissue expression of TCF7L2 in APs correlates positively with donor BMI whilst the T2D risk variant (T) at rs7903146 is associated with reduced AP TCF7L2 expression. Based on these findings we speculate that lean homozygous T2D risk variant carriers would have the lowest AP TCF7L2 expression and conse quently impaired adipogenesis, larger adipocytes, increased adipo-IR and higher susceptibility to T2D compared with obese T2D risk variant carriers.

    Techniques Used: Knockdown, In Vitro, Expressing, Variant Assay

    Related Articles

    Sequencing:

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes.
    Article Snippet: .. The TCF7L2 sequence (from TCF4E pcDNA3, a gift from Frank McCormick, Addgene #32738) [31] was cloned into the pCW57.1 lentiviral vector (gift from David Root, Addgene plasmid #41393) and oligonucleotides for sh843 were cloned into tet-pLKO-puro doxycyclineinducible expression lentiviral vector (gift from Dmitri Wiederschain, Addgene #21915) [32] for inducible TCF7L2 over-expression and KD respectively. ..

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology which may contribute to genetic susceptibility to type 2 diabetes
    Article Snippet: .. The TCF7L2 sequence (from TCF4E pcDNA3, a kind gift from Frank McCormick, Addgene #32738) ( ) was cloned into the tet-pLKO-puro doxycycline-inducible expression lentiviral vector (gift of Dmitri Wiederschain, Addgene #21915) ( ). ..

    Clone Assay:

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes.
    Article Snippet: .. The TCF7L2 sequence (from TCF4E pcDNA3, a gift from Frank McCormick, Addgene #32738) [31] was cloned into the pCW57.1 lentiviral vector (gift from David Root, Addgene plasmid #41393) and oligonucleotides for sh843 were cloned into tet-pLKO-puro doxycyclineinducible expression lentiviral vector (gift from Dmitri Wiederschain, Addgene #21915) [32] for inducible TCF7L2 over-expression and KD respectively. ..

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology which may contribute to genetic susceptibility to type 2 diabetes
    Article Snippet: .. The TCF7L2 sequence (from TCF4E pcDNA3, a kind gift from Frank McCormick, Addgene #32738) ( ) was cloned into the tet-pLKO-puro doxycycline-inducible expression lentiviral vector (gift of Dmitri Wiederschain, Addgene #21915) ( ). ..

    Plasmid Preparation:

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes.
    Article Snippet: .. The TCF7L2 sequence (from TCF4E pcDNA3, a gift from Frank McCormick, Addgene #32738) [31] was cloned into the pCW57.1 lentiviral vector (gift from David Root, Addgene plasmid #41393) and oligonucleotides for sh843 were cloned into tet-pLKO-puro doxycyclineinducible expression lentiviral vector (gift from Dmitri Wiederschain, Addgene #21915) [32] for inducible TCF7L2 over-expression and KD respectively. ..

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology which may contribute to genetic susceptibility to type 2 diabetes
    Article Snippet: .. The TCF7L2 sequence (from TCF4E pcDNA3, a kind gift from Frank McCormick, Addgene #32738) ( ) was cloned into the tet-pLKO-puro doxycycline-inducible expression lentiviral vector (gift of Dmitri Wiederschain, Addgene #21915) ( ). ..

    Expressing:

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes.
    Article Snippet: .. The TCF7L2 sequence (from TCF4E pcDNA3, a gift from Frank McCormick, Addgene #32738) [31] was cloned into the pCW57.1 lentiviral vector (gift from David Root, Addgene plasmid #41393) and oligonucleotides for sh843 were cloned into tet-pLKO-puro doxycyclineinducible expression lentiviral vector (gift from Dmitri Wiederschain, Addgene #21915) [32] for inducible TCF7L2 over-expression and KD respectively. ..

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology which may contribute to genetic susceptibility to type 2 diabetes
    Article Snippet: .. The TCF7L2 sequence (from TCF4E pcDNA3, a kind gift from Frank McCormick, Addgene #32738) ( ) was cloned into the tet-pLKO-puro doxycycline-inducible expression lentiviral vector (gift of Dmitri Wiederschain, Addgene #21915) ( ). ..



    Similar Products

    90
    Genechem tcf7l2-expressing cdna sequence
    Tcf7l2 Expressing Cdna Sequence, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tcf7l2+sequence/small+hairpin+rna++shrna++targeting+tcf7l2+knockdown+lentivirus/pmc11442978-41-9-16
    Average 90 stars, based on 1 article reviews
    tcf7l2-expressing cdna sequence - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Genechem tcf7l2 shrna-sequence
    The JASPAR database was employed to predict the putative transcription factors of Gαi3 ( A ). priPC-1 cells underwent transfection with siRNAs targeting various transcription factors, alongside a negative control siRNA (“siC”) for 48 h, Gαi3 mRNA level was subsequently tested ( B ). priPC-1 cells were modified to express either a lentiviral shRNA targeting <t>TCF7L2</t> (“shTCF7L2”), a scramble control shRNA (“shC”), a lentiviral construct overexpressing TCF7L2 (“oeTCF7L2”), or an empty vector (“Vec”), and the expression of listed mRNAs and proteins was examined ( C – F ). Chromatin immunoprecipitation (ChIP) assays presented the relative levels of TCF7L2-bound Gαi3 promoter in the listed pancreatic cancer cells and primary human pancreatic epithelial cells (“pEpi”) ( G ) as well as in the designated pancreatic cancer tumor tissues (“T”) and matched adjacent normal pancreatic tissues (“N”) ( H ), with results quantified. The data were presented as mean ± standard deviation (SD). * P < 0.05 versus “siC”/“shC”/“Vec” /“pEpi”/“ParaCa” tissues. The experiments depicted in this figure were replicated five times ( n = 5, biological repeats), consistently yielding similar results.
    Tcf7l2 Shrna Sequence, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tcf7l2+sequence/small+hairpin+rna++shrna++targeting+tcf7l2+knockdown+lentivirus/pmc11442978-41-1-16
    Average 90 stars, based on 1 article reviews
    tcf7l2 shrna-sequence - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc tcf7l2 sequence
    Fig. 4. <t>TCF7L2</t> dose-dependently modulates WNT/β-catenin signaling. (A) AXIN2 mRNA levels (one-way ANOVA followed by Tukey's multiple comparisons test), (B) TOPFlash promoter activity following 6 h treatment with vehicle (Veh) or 50 ng/ml WNT3A (n = 12 wells/group) (two-way ANOVA, aaaTreatment * Genotype p < 0.001, bbbTreatment P < 0.001, cccGenotype P < 0.001 followed by ˇSíd´ak's multiple comparisons test), (C) whole cell lysate active β-catenin protein levels (one-way ANOVA followed by Tukey's multiple comparisons test), and (D) TCF7 mRNA levels following TCF7L2 KD in DFAT abdominal APs and primary abdominal APs (n = 2 subjects [0F]; mean age = 45.5. Mean BMI = 29.12; rs7903146 genotype [CC]). (One-way ANOVA followed by Tukey's multiple comparisons test.) (E) TCF7 protein levels in TCF7L2 KD DFAT abdominal APs (one-way ANOVA followed by Tukey's multiple comparisons test). shCN = scrambled control, sh897 = moderate and sh843 = high TCF7L2-KD DFAT abdominal APs. Actin was used as a loading control for western blots. qRT-PCR data were normalized to 18S rRNA levels. Histograms are means ± SEM. Data obtained from 3 independent experiments. ###P < 0.001, ##P < 0.01, #P < 0.05 (adjusted for multiple comparisons).
    Tcf7l2 Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tcf7l2+sequence/Myc-tagged+human+full+length+TCF4E+pcDNA3+(Plasmid+%2332738)/pm35697299-62-1-11
    Average 93 stars, based on 1 article reviews
    tcf7l2 sequence - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Macrogen tcf7l2 gene sequences
    Sequences of both forward and reverse primers were used for <t> TCF7L2 gene </t> amplification.
    Tcf7l2 Gene Sequences, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tcf7l2+sequence/tcf7l2+gene+sequences/pmc08790997-97-3-14
    Average 90 stars, based on 1 article reviews
    tcf7l2 gene sequences - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Genechem binding sites for mir-6882-3p in the 3’-untranslated region (3’-utr) sequence of tcf7l2
    SPRY4‐IT1 modulates expression of <t>TCF7L2</t> protein through sponging miR‐6882‐3p. A, qRT‐PCR was used to identify miRNAs that directly interacted with SPRY4‐IT1. B, The complementary binding of miR‐6882‐3p and SPRY4‐IT1 as well as predicted binding energy. C, Top: Complementary binding of miR‐6882‐3p and wild‐type/mutant SPRY4‐IT1. Bottom: Dual‐luciferase reporter assays indicated the interaction of miR‐6882‐3p and SPRY4‐IT1. D, Complementary binding of miR‐6882‐3p and TCF7L2 3’‐UTR as well as predicted binding energy. E, Top: Complementary binding of miR‐6882‐3p and wild‐type/mutant TCF7L2 3’‐UTR. Bottom: Dual‐luciferase reporter assays showed the combination of miR‐6882‐3p and TCF7L2 3’‐UTR. F Wnt1/β‐catenin signalling pathway‐related protein expression (TCF7L2, Wnt1, β‐catenin (Nuclear) and Nanog) was measured by western blotting after overexpression of SPRY4‐IT1 and transfection with miR‐6882‐3p or miR‐NC in MCF‐7 cells. G Wnt1/β‐catenin signalling pathway‐related protein expression (TCF7L2, Wnt1, β‐catenin (Nuclear) and Nanog) was measured by western blotting after knockdown of SPRY4‐IT1 and transfection with miR‐6882‐3p or miR‐NC in MCF‐7 CSCs. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < .05, ** P < .01, *** P < .001, **** P < .0001
    Binding Sites For Mir 6882 3p In The 3’ Untranslated Region (3’ Utr) Sequence Of Tcf7l2, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tcf7l2+sequence/small+hairpin+rna++shrna++targeting+tcf7l2+knockdown+lentivirus/pmc06933354-64-13-17
    Average 90 stars, based on 1 article reviews
    binding sites for mir-6882-3p in the 3’-untranslated region (3’-utr) sequence of tcf7l2 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Genechem binding sites for mir-5582-3p in the 3′-untranslated region (3′-utr) sequence of tcf7l2
    Correlation analysis of LUCAT1 expression and SOX2 and <t> TCF7L2 </t>
    Binding Sites For Mir 5582 3p In The 3′ Untranslated Region (3′ Utr) Sequence Of Tcf7l2, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tcf7l2+sequence/small+hairpin+rna++shrna++targeting+tcf7l2+knockdown+lentivirus/pmc06626338-156-13-17
    Average 90 stars, based on 1 article reviews
    binding sites for mir-5582-3p in the 3′-untranslated region (3′-utr) sequence of tcf7l2 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    The JASPAR database was employed to predict the putative transcription factors of Gαi3 ( A ). priPC-1 cells underwent transfection with siRNAs targeting various transcription factors, alongside a negative control siRNA (“siC”) for 48 h, Gαi3 mRNA level was subsequently tested ( B ). priPC-1 cells were modified to express either a lentiviral shRNA targeting TCF7L2 (“shTCF7L2”), a scramble control shRNA (“shC”), a lentiviral construct overexpressing TCF7L2 (“oeTCF7L2”), or an empty vector (“Vec”), and the expression of listed mRNAs and proteins was examined ( C – F ). Chromatin immunoprecipitation (ChIP) assays presented the relative levels of TCF7L2-bound Gαi3 promoter in the listed pancreatic cancer cells and primary human pancreatic epithelial cells (“pEpi”) ( G ) as well as in the designated pancreatic cancer tumor tissues (“T”) and matched adjacent normal pancreatic tissues (“N”) ( H ), with results quantified. The data were presented as mean ± standard deviation (SD). * P < 0.05 versus “siC”/“shC”/“Vec” /“pEpi”/“ParaCa” tissues. The experiments depicted in this figure were replicated five times ( n = 5, biological repeats), consistently yielding similar results.

    Journal: Cell Death & Disease

    Article Title: Identification of Gαi3 as a promising molecular oncotarget of pancreatic cancer

    doi: 10.1038/s41419-024-07079-6

    Figure Lengend Snippet: The JASPAR database was employed to predict the putative transcription factors of Gαi3 ( A ). priPC-1 cells underwent transfection with siRNAs targeting various transcription factors, alongside a negative control siRNA (“siC”) for 48 h, Gαi3 mRNA level was subsequently tested ( B ). priPC-1 cells were modified to express either a lentiviral shRNA targeting TCF7L2 (“shTCF7L2”), a scramble control shRNA (“shC”), a lentiviral construct overexpressing TCF7L2 (“oeTCF7L2”), or an empty vector (“Vec”), and the expression of listed mRNAs and proteins was examined ( C – F ). Chromatin immunoprecipitation (ChIP) assays presented the relative levels of TCF7L2-bound Gαi3 promoter in the listed pancreatic cancer cells and primary human pancreatic epithelial cells (“pEpi”) ( G ) as well as in the designated pancreatic cancer tumor tissues (“T”) and matched adjacent normal pancreatic tissues (“N”) ( H ), with results quantified. The data were presented as mean ± standard deviation (SD). * P < 0.05 versus “siC”/“shC”/“Vec” /“pEpi”/“ParaCa” tissues. The experiments depicted in this figure were replicated five times ( n = 5, biological repeats), consistently yielding similar results.

    Article Snippet: The TCF7L2 shRNA-sequence (targeting 5’- CCTCCGCACCCTCCAGATATATC -3’) and the TCF7L2-expressing cDNA sequence ([NM_030756.5]) were custom-synthesized by Genechem in Shanghai, China.

    Techniques: Transfection, Negative Control, Modification, shRNA, Control, Construct, Plasmid Preparation, Expressing, Chromatin Immunoprecipitation, Standard Deviation

    The current study emphasizes the complex role of Gαi3 in promoting the growth of pancreatic cancer cells by regulating the Akt-mTOR and PKA-Hippo-YAP signaling pathways. TCF7L2 is a crucial transcription factor for Gαi3, driving its upregulation in pancreatic cancer.

    Journal: Cell Death & Disease

    Article Title: Identification of Gαi3 as a promising molecular oncotarget of pancreatic cancer

    doi: 10.1038/s41419-024-07079-6

    Figure Lengend Snippet: The current study emphasizes the complex role of Gαi3 in promoting the growth of pancreatic cancer cells by regulating the Akt-mTOR and PKA-Hippo-YAP signaling pathways. TCF7L2 is a crucial transcription factor for Gαi3, driving its upregulation in pancreatic cancer.

    Article Snippet: The TCF7L2 shRNA-sequence (targeting 5’- CCTCCGCACCCTCCAGATATATC -3’) and the TCF7L2-expressing cDNA sequence ([NM_030756.5]) were custom-synthesized by Genechem in Shanghai, China.

    Techniques: Protein-Protein interactions

    Fig. 4. TCF7L2 dose-dependently modulates WNT/β-catenin signaling. (A) AXIN2 mRNA levels (one-way ANOVA followed by Tukey's multiple comparisons test), (B) TOPFlash promoter activity following 6 h treatment with vehicle (Veh) or 50 ng/ml WNT3A (n = 12 wells/group) (two-way ANOVA, aaaTreatment * Genotype p < 0.001, bbbTreatment P < 0.001, cccGenotype P < 0.001 followed by ˇSíd´ak's multiple comparisons test), (C) whole cell lysate active β-catenin protein levels (one-way ANOVA followed by Tukey's multiple comparisons test), and (D) TCF7 mRNA levels following TCF7L2 KD in DFAT abdominal APs and primary abdominal APs (n = 2 subjects [0F]; mean age = 45.5. Mean BMI = 29.12; rs7903146 genotype [CC]). (One-way ANOVA followed by Tukey's multiple comparisons test.) (E) TCF7 protein levels in TCF7L2 KD DFAT abdominal APs (one-way ANOVA followed by Tukey's multiple comparisons test). shCN = scrambled control, sh897 = moderate and sh843 = high TCF7L2-KD DFAT abdominal APs. Actin was used as a loading control for western blots. qRT-PCR data were normalized to 18S rRNA levels. Histograms are means ± SEM. Data obtained from 3 independent experiments. ###P < 0.001, ##P < 0.01, #P < 0.05 (adjusted for multiple comparisons).

    Journal: Metabolism: clinical and experimental

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes.

    doi: 10.1016/j.metabol.2022.155240

    Figure Lengend Snippet: Fig. 4. TCF7L2 dose-dependently modulates WNT/β-catenin signaling. (A) AXIN2 mRNA levels (one-way ANOVA followed by Tukey's multiple comparisons test), (B) TOPFlash promoter activity following 6 h treatment with vehicle (Veh) or 50 ng/ml WNT3A (n = 12 wells/group) (two-way ANOVA, aaaTreatment * Genotype p < 0.001, bbbTreatment P < 0.001, cccGenotype P < 0.001 followed by ˇSíd´ak's multiple comparisons test), (C) whole cell lysate active β-catenin protein levels (one-way ANOVA followed by Tukey's multiple comparisons test), and (D) TCF7 mRNA levels following TCF7L2 KD in DFAT abdominal APs and primary abdominal APs (n = 2 subjects [0F]; mean age = 45.5. Mean BMI = 29.12; rs7903146 genotype [CC]). (One-way ANOVA followed by Tukey's multiple comparisons test.) (E) TCF7 protein levels in TCF7L2 KD DFAT abdominal APs (one-way ANOVA followed by Tukey's multiple comparisons test). shCN = scrambled control, sh897 = moderate and sh843 = high TCF7L2-KD DFAT abdominal APs. Actin was used as a loading control for western blots. qRT-PCR data were normalized to 18S rRNA levels. Histograms are means ± SEM. Data obtained from 3 independent experiments. ###P < 0.001, ##P < 0.01, #P < 0.05 (adjusted for multiple comparisons).

    Article Snippet: The TCF7L2 sequence (from TCF4E pcDNA3, a gift from Frank McCormick, Addgene #32738) [31] was cloned into the pCW57.1 lentiviral vector (gift from David Root, Addgene plasmid #41393) and oligonucleotides for sh843 were cloned into tet-pLKO-puro doxycyclineinducible expression lentiviral vector (gift from Dmitri Wiederschain, Addgene #21915) [32] for inducible TCF7L2 over-expression and KD respectively.

    Techniques: Activity Assay, Control, Western Blot, Quantitative RT-PCR

    Fig. 5. Global transcriptional profiling reveals that TCF7L2 regulates multiple aspects of AP biology. (A) Principal component analysis (PCA) of the global tran scriptomic profile of control (scrambled), moderate (sh897) and high-efficiency (sh843) TCF7L2-KD DFAT abdominal APs over 3 independent passages. (B) Venn diagram showing the overlap between differentially regulated genes from paired comparisons (FDR < 0.05). (C and D) Volcano plots showing the genes differentially regulated between control and (C) sh843 (TCF7 was one of top 30 differentially regulated genes highlighted in yellow); or (D) sh897, TCF7L2-KD DFAT abdominal APs. Highlighted are the top 30 differentially regulated genes. (E) Overrepresentation analyses of genes differentially regulated in sh843 and sh897 DFAT abdominal APs, vs. controls in gene ontology biological processes gene sets. P-value was adjusted using the FDR (Benjamini-Hochberg) procedure. Gene ratio represents the percentage of total DEGs in the given GO term. (F) Dimensional reduction of transcription factors similarity by co-regulation of targets (see Supplementary methods). Colors represent high dimensional clustering by affinity propagation. (G) Dendrogram of transcription factors Euclidean distance. (H) JUB, MEF2A and TEAD1 expression levels in high- and low-efficiency TCF7L2-KD cells (vs. scramble control) are shown. Padj is annotated for RNAseq log2 fold-change measurements. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Journal: Metabolism: clinical and experimental

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes.

    doi: 10.1016/j.metabol.2022.155240

    Figure Lengend Snippet: Fig. 5. Global transcriptional profiling reveals that TCF7L2 regulates multiple aspects of AP biology. (A) Principal component analysis (PCA) of the global tran scriptomic profile of control (scrambled), moderate (sh897) and high-efficiency (sh843) TCF7L2-KD DFAT abdominal APs over 3 independent passages. (B) Venn diagram showing the overlap between differentially regulated genes from paired comparisons (FDR < 0.05). (C and D) Volcano plots showing the genes differentially regulated between control and (C) sh843 (TCF7 was one of top 30 differentially regulated genes highlighted in yellow); or (D) sh897, TCF7L2-KD DFAT abdominal APs. Highlighted are the top 30 differentially regulated genes. (E) Overrepresentation analyses of genes differentially regulated in sh843 and sh897 DFAT abdominal APs, vs. controls in gene ontology biological processes gene sets. P-value was adjusted using the FDR (Benjamini-Hochberg) procedure. Gene ratio represents the percentage of total DEGs in the given GO term. (F) Dimensional reduction of transcription factors similarity by co-regulation of targets (see Supplementary methods). Colors represent high dimensional clustering by affinity propagation. (G) Dendrogram of transcription factors Euclidean distance. (H) JUB, MEF2A and TEAD1 expression levels in high- and low-efficiency TCF7L2-KD cells (vs. scramble control) are shown. Padj is annotated for RNAseq log2 fold-change measurements. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Article Snippet: The TCF7L2 sequence (from TCF4E pcDNA3, a gift from Frank McCormick, Addgene #32738) [31] was cloned into the pCW57.1 lentiviral vector (gift from David Root, Addgene plasmid #41393) and oligonucleotides for sh843 were cloned into tet-pLKO-puro doxycyclineinducible expression lentiviral vector (gift from Dmitri Wiederschain, Addgene #21915) [32] for inducible TCF7L2 over-expression and KD respectively.

    Techniques: Control, Expressing

    Fig. 7. Schematic summarizing the role of TCF7L2 and impact of rs7903146 genotype on human AP biology. TCF7L2 has dose-dependent effects on adipo genesis with moderate and high-efficiency knockdown leading to enhanced and impaired adipogenesis respectively in vitro. In fractionated adipose tissue expression of TCF7L2 in APs correlates positively with donor BMI whilst the T2D risk variant (T) at rs7903146 is associated with reduced AP TCF7L2 expression. Based on these findings we speculate that lean homozygous T2D risk variant carriers would have the lowest AP TCF7L2 expression and conse quently impaired adipogenesis, larger adipocytes, increased adipo-IR and higher susceptibility to T2D compared with obese T2D risk variant carriers.

    Journal: Metabolism: clinical and experimental

    Article Title: TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes.

    doi: 10.1016/j.metabol.2022.155240

    Figure Lengend Snippet: Fig. 7. Schematic summarizing the role of TCF7L2 and impact of rs7903146 genotype on human AP biology. TCF7L2 has dose-dependent effects on adipo genesis with moderate and high-efficiency knockdown leading to enhanced and impaired adipogenesis respectively in vitro. In fractionated adipose tissue expression of TCF7L2 in APs correlates positively with donor BMI whilst the T2D risk variant (T) at rs7903146 is associated with reduced AP TCF7L2 expression. Based on these findings we speculate that lean homozygous T2D risk variant carriers would have the lowest AP TCF7L2 expression and conse quently impaired adipogenesis, larger adipocytes, increased adipo-IR and higher susceptibility to T2D compared with obese T2D risk variant carriers.

    Article Snippet: The TCF7L2 sequence (from TCF4E pcDNA3, a gift from Frank McCormick, Addgene #32738) [31] was cloned into the pCW57.1 lentiviral vector (gift from David Root, Addgene plasmid #41393) and oligonucleotides for sh843 were cloned into tet-pLKO-puro doxycyclineinducible expression lentiviral vector (gift from Dmitri Wiederschain, Addgene #21915) [32] for inducible TCF7L2 over-expression and KD respectively.

    Techniques: Knockdown, In Vitro, Expressing, Variant Assay

    Sequences of both forward and reverse primers were used for  TCF7L2 gene  amplification.

    Journal: Archives of Razi Institute

    Article Title: Sequence Analysis of Transcription Factor 7-like 2 Protein (TCF7L2) in Iraqi Patients with Diabetic Mellitus Type 2 Using Bioinformatics Methods

    doi: 10.22092/ari.2021.355851.1729

    Figure Lengend Snippet: Sequences of both forward and reverse primers were used for TCF7L2 gene amplification.

    Article Snippet: The results of TCF7L2 gene sequences for 10 patients with T2DM were received from Macrogen Company, Korea, and then analyzed using BLAST software.

    Techniques: Amplification, Sequencing

    Components of polymerase chain reaction solution for amplification of  TCF7L2 gene.

    Journal: Archives of Razi Institute

    Article Title: Sequence Analysis of Transcription Factor 7-like 2 Protein (TCF7L2) in Iraqi Patients with Diabetic Mellitus Type 2 Using Bioinformatics Methods

    doi: 10.22092/ari.2021.355851.1729

    Figure Lengend Snippet: Components of polymerase chain reaction solution for amplification of TCF7L2 gene.

    Article Snippet: The results of TCF7L2 gene sequences for 10 patients with T2DM were received from Macrogen Company, Korea, and then analyzed using BLAST software.

    Techniques: Polymerase Chain Reaction, Amplification, Concentration Assay

    The optimum conditions of the detection of  TCF7L2 gene.

    Journal: Archives of Razi Institute

    Article Title: Sequence Analysis of Transcription Factor 7-like 2 Protein (TCF7L2) in Iraqi Patients with Diabetic Mellitus Type 2 Using Bioinformatics Methods

    doi: 10.22092/ari.2021.355851.1729

    Figure Lengend Snippet: The optimum conditions of the detection of TCF7L2 gene.

    Article Snippet: The results of TCF7L2 gene sequences for 10 patients with T2DM were received from Macrogen Company, Korea, and then analyzed using BLAST software.

    Techniques:

    Products of polymerase chain reaction gel electrophoresis on 2% agarose showed clear bands with the size of 888bp of TCF7L2 gene in Iraqi patients with type 2 diabetes mellitus.

    Journal: Archives of Razi Institute

    Article Title: Sequence Analysis of Transcription Factor 7-like 2 Protein (TCF7L2) in Iraqi Patients with Diabetic Mellitus Type 2 Using Bioinformatics Methods

    doi: 10.22092/ari.2021.355851.1729

    Figure Lengend Snippet: Products of polymerase chain reaction gel electrophoresis on 2% agarose showed clear bands with the size of 888bp of TCF7L2 gene in Iraqi patients with type 2 diabetes mellitus.

    Article Snippet: The results of TCF7L2 gene sequences for 10 patients with T2DM were received from Macrogen Company, Korea, and then analyzed using BLAST software.

    Techniques: Polymerase Chain Reaction, Nucleic Acid Electrophoresis

    Results of alignment between the sequence of TCF7L2 gene for T2DM patient (query) and the sequence of TCF7L2 gene in National Center for Biotechnology Information (sbjct) by BLAST software, where the mutation appeared between the sites 104074 and 104288 (indicated by the blue arrow).

    Journal: Archives of Razi Institute

    Article Title: Sequence Analysis of Transcription Factor 7-like 2 Protein (TCF7L2) in Iraqi Patients with Diabetic Mellitus Type 2 Using Bioinformatics Methods

    doi: 10.22092/ari.2021.355851.1729

    Figure Lengend Snippet: Results of alignment between the sequence of TCF7L2 gene for T2DM patient (query) and the sequence of TCF7L2 gene in National Center for Biotechnology Information (sbjct) by BLAST software, where the mutation appeared between the sites 104074 and 104288 (indicated by the blue arrow).

    Article Snippet: The results of TCF7L2 gene sequences for 10 patients with T2DM were received from Macrogen Company, Korea, and then analyzed using BLAST software.

    Techniques: Sequencing, Software, Mutagenesis

    SPRY4‐IT1 modulates expression of TCF7L2 protein through sponging miR‐6882‐3p. A, qRT‐PCR was used to identify miRNAs that directly interacted with SPRY4‐IT1. B, The complementary binding of miR‐6882‐3p and SPRY4‐IT1 as well as predicted binding energy. C, Top: Complementary binding of miR‐6882‐3p and wild‐type/mutant SPRY4‐IT1. Bottom: Dual‐luciferase reporter assays indicated the interaction of miR‐6882‐3p and SPRY4‐IT1. D, Complementary binding of miR‐6882‐3p and TCF7L2 3’‐UTR as well as predicted binding energy. E, Top: Complementary binding of miR‐6882‐3p and wild‐type/mutant TCF7L2 3’‐UTR. Bottom: Dual‐luciferase reporter assays showed the combination of miR‐6882‐3p and TCF7L2 3’‐UTR. F Wnt1/β‐catenin signalling pathway‐related protein expression (TCF7L2, Wnt1, β‐catenin (Nuclear) and Nanog) was measured by western blotting after overexpression of SPRY4‐IT1 and transfection with miR‐6882‐3p or miR‐NC in MCF‐7 cells. G Wnt1/β‐catenin signalling pathway‐related protein expression (TCF7L2, Wnt1, β‐catenin (Nuclear) and Nanog) was measured by western blotting after knockdown of SPRY4‐IT1 and transfection with miR‐6882‐3p or miR‐NC in MCF‐7 CSCs. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < .05, ** P < .01, *** P < .001, **** P < .0001

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA SPRY4‐IT1 regulates breast cancer cell stemness through competitively binding miR‐6882‐3p with TCF7L2

    doi: 10.1111/jcmm.14786

    Figure Lengend Snippet: SPRY4‐IT1 modulates expression of TCF7L2 protein through sponging miR‐6882‐3p. A, qRT‐PCR was used to identify miRNAs that directly interacted with SPRY4‐IT1. B, The complementary binding of miR‐6882‐3p and SPRY4‐IT1 as well as predicted binding energy. C, Top: Complementary binding of miR‐6882‐3p and wild‐type/mutant SPRY4‐IT1. Bottom: Dual‐luciferase reporter assays indicated the interaction of miR‐6882‐3p and SPRY4‐IT1. D, Complementary binding of miR‐6882‐3p and TCF7L2 3’‐UTR as well as predicted binding energy. E, Top: Complementary binding of miR‐6882‐3p and wild‐type/mutant TCF7L2 3’‐UTR. Bottom: Dual‐luciferase reporter assays showed the combination of miR‐6882‐3p and TCF7L2 3’‐UTR. F Wnt1/β‐catenin signalling pathway‐related protein expression (TCF7L2, Wnt1, β‐catenin (Nuclear) and Nanog) was measured by western blotting after overexpression of SPRY4‐IT1 and transfection with miR‐6882‐3p or miR‐NC in MCF‐7 cells. G Wnt1/β‐catenin signalling pathway‐related protein expression (TCF7L2, Wnt1, β‐catenin (Nuclear) and Nanog) was measured by western blotting after knockdown of SPRY4‐IT1 and transfection with miR‐6882‐3p or miR‐NC in MCF‐7 CSCs. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < .05, ** P < .01, *** P < .001, **** P < .0001

    Article Snippet: Similarly, the binding sites for miR‐6882‐3p in the 3’‐untranslated region (3’‐UTR) sequence of TCF7L2 were purchased from Genechem.

    Techniques: Expressing, Quantitative RT-PCR, Binding Assay, Mutagenesis, Luciferase, Western Blot, Over Expression, Transfection, Knockdown

    SPRY4‐IT1 enhances the stemness of BCSCs in vivo . A, Subcutaneous tumour from the SPRY4‐IT1 overexpression (oe‐SPRY4‐IT1) group and negative control group. B, Images of oe‐SPRY4‐IIT1 MCF7 tumour tissues. C, Average tumour volumes were measured in xenograft mice every two days. D, Images of average tumour weight at the end of indicated treatment. E, Immunohistochemistry analysis of TCF7L2, Nanog and Ki‐67 protein levels in tumour tissues formed from SPRY4‐IT1‐overexpressing cells or control cells. Original magnification, ×400. Scale bars, 50 μm. F, Wnt1/β‐catenin signalling pathway‐related protein expression (TCF7L2, Wnt1, β‐catenin (Nuclear) and Nanog) was measured by western blotting in oe‐NC and oe‐SPRY4‐IT1 groups. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < .05, ** P < .01, *** P < .001, **** P < .0001

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA SPRY4‐IT1 regulates breast cancer cell stemness through competitively binding miR‐6882‐3p with TCF7L2

    doi: 10.1111/jcmm.14786

    Figure Lengend Snippet: SPRY4‐IT1 enhances the stemness of BCSCs in vivo . A, Subcutaneous tumour from the SPRY4‐IT1 overexpression (oe‐SPRY4‐IT1) group and negative control group. B, Images of oe‐SPRY4‐IIT1 MCF7 tumour tissues. C, Average tumour volumes were measured in xenograft mice every two days. D, Images of average tumour weight at the end of indicated treatment. E, Immunohistochemistry analysis of TCF7L2, Nanog and Ki‐67 protein levels in tumour tissues formed from SPRY4‐IT1‐overexpressing cells or control cells. Original magnification, ×400. Scale bars, 50 μm. F, Wnt1/β‐catenin signalling pathway‐related protein expression (TCF7L2, Wnt1, β‐catenin (Nuclear) and Nanog) was measured by western blotting in oe‐NC and oe‐SPRY4‐IT1 groups. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < .05, ** P < .01, *** P < .001, **** P < .0001

    Article Snippet: Similarly, the binding sites for miR‐6882‐3p in the 3’‐untranslated region (3’‐UTR) sequence of TCF7L2 were purchased from Genechem.

    Techniques: In Vivo, Over Expression, Negative Control, Immunohistochemistry, Control, Expressing, Western Blot

    A schematic model indicating that SPRY4‐IT1 competitively binds to miR‐217 and TCF7L2, consequently regulating the Wnt/β‐catenin signalling pathway to promote stemness of breast cancer cells

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA SPRY4‐IT1 regulates breast cancer cell stemness through competitively binding miR‐6882‐3p with TCF7L2

    doi: 10.1111/jcmm.14786

    Figure Lengend Snippet: A schematic model indicating that SPRY4‐IT1 competitively binds to miR‐217 and TCF7L2, consequently regulating the Wnt/β‐catenin signalling pathway to promote stemness of breast cancer cells

    Article Snippet: Similarly, the binding sites for miR‐6882‐3p in the 3’‐untranslated region (3’‐UTR) sequence of TCF7L2 were purchased from Genechem.

    Techniques:

    Correlation analysis of LUCAT1 expression and SOX2 and  TCF7L2

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Long non-coding RNA LUCAT1/miR-5582-3p/TCF7L2 axis regulates breast cancer stemness via Wnt/β-catenin pathway

    doi: 10.1186/s13046-019-1315-8

    Figure Lengend Snippet: Correlation analysis of LUCAT1 expression and SOX2 and TCF7L2

    Article Snippet: Similarly, the binding sites for miR-5582-3p in the 3′-untranslated region (3′-UTR) sequence of TCF7L2 were obtained from Genechem.

    Techniques: Expressing

    LUCAT1 competitively binds miR-5582-3p with TCF7L2 and enhances Wnt/β-Catenin pathway. a Left: The complementary binding of miR-5582-3p and wild/mutant type of LUCAT1. Right: Dual luciferase reporter assays indicated the combination of miR-5582-3p and LUCAT1. b MCF-7 cell lysates were incubated with biotinlabeled LUCAT1 and LUCAT1-mut. MiRNA real-time PCR was performed after pull down process. c Left: The complementary binding of miR-5582-3p and wild/mutant type of TCF7L2 3′-UTR. Right: Dual luciferase reporter assays showed the combination of miR-5582-3p and TCF7L2 3′-UTR. d RNA sequencing data of TCGA database demonstrated that there was a positive correlation between LUCAT1 and TCF7L2 expression. e The qRT-PCR results of the RIP based on Ago2 showed that lncRNAs can compete with the TCF7L2 transcript for the binding of miRNAs. f The effect on TOP/FOP reporter activity in MCF-7 cells transfected with LUCAT1 overexpression vector or sh-LUCAT1 vector was proved by dual-luciferase assay. A Renilla transfection control normalized all results. g The effect on TOP/FOP reporter activity in MCF-7 cells after transfection with control or miR-5582-3p mimic, oe-LUCAT1 or oe-NC plasmid was validated by dual-luciferase assay. h SOX2 and Wnt/β-catenin pathway-related protein expression (total TCF7L2 and Wnt1 proteins, total and nuclear β-catenin proteins) were measured by western blot in different groups of MCF-7. i The effect on TOP/FOP reporter activity in MCF-7CSCs cells after transfection with control or miR-5582-3p inhibitor, sh-LUCAT1 or sh-NC plasmid, was validated by dual-luciferase assay. j SOX2 and Wnt/β-catenin signaling pathway-related protein expression (total TCF7L2 and Wnt1 proteins, total and nuclear β-catenin proteins) were detected by western blot in different groups of MCF-7 CSCs. β-actin and Lamin B1 were used as an internal control and an endogenous control of cell nuclear fraction, respectively. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Long non-coding RNA LUCAT1/miR-5582-3p/TCF7L2 axis regulates breast cancer stemness via Wnt/β-catenin pathway

    doi: 10.1186/s13046-019-1315-8

    Figure Lengend Snippet: LUCAT1 competitively binds miR-5582-3p with TCF7L2 and enhances Wnt/β-Catenin pathway. a Left: The complementary binding of miR-5582-3p and wild/mutant type of LUCAT1. Right: Dual luciferase reporter assays indicated the combination of miR-5582-3p and LUCAT1. b MCF-7 cell lysates were incubated with biotinlabeled LUCAT1 and LUCAT1-mut. MiRNA real-time PCR was performed after pull down process. c Left: The complementary binding of miR-5582-3p and wild/mutant type of TCF7L2 3′-UTR. Right: Dual luciferase reporter assays showed the combination of miR-5582-3p and TCF7L2 3′-UTR. d RNA sequencing data of TCGA database demonstrated that there was a positive correlation between LUCAT1 and TCF7L2 expression. e The qRT-PCR results of the RIP based on Ago2 showed that lncRNAs can compete with the TCF7L2 transcript for the binding of miRNAs. f The effect on TOP/FOP reporter activity in MCF-7 cells transfected with LUCAT1 overexpression vector or sh-LUCAT1 vector was proved by dual-luciferase assay. A Renilla transfection control normalized all results. g The effect on TOP/FOP reporter activity in MCF-7 cells after transfection with control or miR-5582-3p mimic, oe-LUCAT1 or oe-NC plasmid was validated by dual-luciferase assay. h SOX2 and Wnt/β-catenin pathway-related protein expression (total TCF7L2 and Wnt1 proteins, total and nuclear β-catenin proteins) were measured by western blot in different groups of MCF-7. i The effect on TOP/FOP reporter activity in MCF-7CSCs cells after transfection with control or miR-5582-3p inhibitor, sh-LUCAT1 or sh-NC plasmid, was validated by dual-luciferase assay. j SOX2 and Wnt/β-catenin signaling pathway-related protein expression (total TCF7L2 and Wnt1 proteins, total and nuclear β-catenin proteins) were detected by western blot in different groups of MCF-7 CSCs. β-actin and Lamin B1 were used as an internal control and an endogenous control of cell nuclear fraction, respectively. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001

    Article Snippet: Similarly, the binding sites for miR-5582-3p in the 3′-untranslated region (3′-UTR) sequence of TCF7L2 were obtained from Genechem.

    Techniques: Binding Assay, Mutagenesis, Luciferase, Incubation, miRNA RT, RNA Sequencing, Expressing, Quantitative RT-PCR, Activity Assay, Transfection, Over Expression, Plasmid Preparation, Control, Western Blot

    The regulatory mechanism of LUCAT1/miR-5582-3p/TCF7L2 axis and Wnt/β-catenin pathway in vivo. a Subcutaneous tumor was taken in four groups. b The isolated tumors were separated from xenograft mice. c Average tumor volumes were measured in xenograft mice every two days. d Images of average tumor weight at the end of indicated treatment. e Wnt/β-catenin signaling pathway-related protein expression (total TCF7L2 and Wnt1 proteins, total and nuclear β-catenin proteins) and SOX2 were measured in four groups by western blot. f TCF7L2 and SOX2 protein levels were detected in tumor tissues in four groups by IHC. Original magnification, × 400. Scale bars, 50 μm. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Long non-coding RNA LUCAT1/miR-5582-3p/TCF7L2 axis regulates breast cancer stemness via Wnt/β-catenin pathway

    doi: 10.1186/s13046-019-1315-8

    Figure Lengend Snippet: The regulatory mechanism of LUCAT1/miR-5582-3p/TCF7L2 axis and Wnt/β-catenin pathway in vivo. a Subcutaneous tumor was taken in four groups. b The isolated tumors were separated from xenograft mice. c Average tumor volumes were measured in xenograft mice every two days. d Images of average tumor weight at the end of indicated treatment. e Wnt/β-catenin signaling pathway-related protein expression (total TCF7L2 and Wnt1 proteins, total and nuclear β-catenin proteins) and SOX2 were measured in four groups by western blot. f TCF7L2 and SOX2 protein levels were detected in tumor tissues in four groups by IHC. Original magnification, × 400. Scale bars, 50 μm. Data are presented as the mean ± SD of three independent experiments performed in triplicate. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001

    Article Snippet: Similarly, the binding sites for miR-5582-3p in the 3′-untranslated region (3′-UTR) sequence of TCF7L2 were obtained from Genechem.

    Techniques: In Vivo, Isolation, Expressing, Western Blot

    A schematic model showing that LUCAT1 regulates breast cancer stemness by competitively binding to miR-5582-3p and TCF7L2 and consequently regulates the Wnt/β-catenin signaling pathway

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Long non-coding RNA LUCAT1/miR-5582-3p/TCF7L2 axis regulates breast cancer stemness via Wnt/β-catenin pathway

    doi: 10.1186/s13046-019-1315-8

    Figure Lengend Snippet: A schematic model showing that LUCAT1 regulates breast cancer stemness by competitively binding to miR-5582-3p and TCF7L2 and consequently regulates the Wnt/β-catenin signaling pathway

    Article Snippet: Similarly, the binding sites for miR-5582-3p in the 3′-untranslated region (3′-UTR) sequence of TCF7L2 were obtained from Genechem.

    Techniques: Binding Assay